Disclaimer: You are now leaving www.HIVReagentProgram.org and are going to a website that is not operated by NIH HIV Reagent Program. We are not responsible for the content or availability of linked sites.
ABOUT THIRD PARTY LINKS ON OUR SITE: NIH HIV Reagent Program offers links to other third party websites that may be of interest to our website visitors. The links provided in our website are provided solely for your convenience and may assist you in locating other useful information on the Internet. When you click on these links, you will leave the NIH HIV Reagent Program website and will be redirected to another site. These sites are not under the control of NIH HIV Reagent Program. NIH HIV Reagent Program is not responsible for the content of linked third party websites. We are neither an agent for these third parties nor do we endorse or guarantee their products. We make no representation or warranty regarding the accuracy of the information contained in the linked sites. We suggest that you always verify the information obtained from linked websites before acting upon this information. Please read third party privacy and security policies closely as these may be different than NIH HIV Reagent Program policies. If you have any questions or concerns about the products and services offered on linked third party websites, please contact the third party directly.
-70°C or colder
Quantity limit per order for this item is 1. This item can be ordered twice a year. Orders over this limit will be sent to NIAID for approval before shipment.
ARP-2134 [CAT Reporter Vector (pIL-2r)] is a reporter vector containing a synthetic 26 base pair oligonucleotide containing the alpha subunit of the IL-2 receptor (IL-2Rα) NF-κB binding site (-268 through -243) was cloned into the SalI site of plasmid Δ56, a minimal c-fos promoter/CAT reporter plasmid. The synthetic κB oligonucleotide sequence is: (-268) GGGGAATCTCCCTCTCCTTTTATGGG (-243). The κB enhancer drives increased CAT expression in transfected S194 myeloma and 3T3 cells. This activity is further increased by LPS stimulation of these B-cell lines. CAT expression in Jurkat T cells occurs after PMA stimulation, but does not occur in the absence of mitogen induction. Double digestion of the plasmid with EcoRI and HindIII produces a 500 kb fragment containing the insert as well as 2650 kb and 2130 kb fragments. Digestion with HincII produces a 1750 kb fragment containing the insert, as well as 2900 kb, 370 kb and 240 kb fragments.
Each vial of ARP-2134 contains 1 mL of E. coli, strain DH5α transformed with pIL-2r. Please refer to the attached file(s) for more information.
Pierce, J. W., M. Lenardo and D. Baltimore. “Oligonucleotide that Binds Nuclear Factor NF-κB Acts as a Lymphoid-Specific and Inducible Enhancer Element.” Proc. Natl. Acad. Sci. USA 85 (1988):1482-1486. PubMed: 3125549.
Gilman, M. Z., R. N. Wilson and R. A. Weinberg. “Multiple Protein-Binding Sites in the 5'-Flanking Region Regulate C-fos Expression.” Mol. Cell. Biol. 6 (1986): 4305-4316. PubMed: 3025651.
Scientists at for-profit institutions or who intend commercial use of this reagent must contact the NIH Office of Technology Transfer, Email: NIAIDAIDSReagent@niaid.nih.gov, before the reagent can be released. Please specify the name and a description of the intended use of the reagent.
When applying for permits and forms please:
Do NOT reference NIH HIV Reagent Program or ATCC Catalog Numbers in the Material Description fields found on the permits and/or forms.
Make sure your name and address on the permit applications and/or forms are exactly as they appear on your NIH HIV Reagent Program registration.
Information about permits is provided as a courtesy to NIH HIV Reagent Program customers. While we use reasonable efforts to include accurate and up-to-date information on this page, we make no warranties or representation as to its accuracy.
For more information on the necessary compliance requirements associated with the biological materials provided by NIH HIV Reagent Program, please select this link: Compliance Requirements.